SNP position on the B. anthracis Ames ancestor genome 31-mer sequence Number of matches Annotation
4083672 TGTGCCCCATCCTGAGCATACAACTTTATAA 2 nucleotidyltransferase GBAA_4491
4136672 ACATAGAACAAGTGACATTCTATCAAACGGT 2 intergenic region between spore protease GBAA_4546 and S20 ribosomas protein GBAA_4547